Claim: Offguardian article claiming that Covid PCR testing is flawed and not reliable

themaxednoob

New Member
https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/

Well known conspiracy site Off-guardian has made claims about covid not being real due to many reasons including no "purified" isolated sample of the virus (which there is) and most specifically for this topic, PCR tests not being accurate or trustworthy. For the sake of focusing on one claim and saving time, we'll talk about their claim on the PCR tests. The "no isolated virus" argument has been torn apart already.

Let's go by what they are saying relating to this quote by quote (something they can't do in their own article if you bothered to skim through it)

"Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences."
They used a BLAST tool found on the NIH page to test if the SARs gene sequences were unique or not

"The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2."
They are talking about the specific gene sequence that identifies the covid 19 virus

"However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes."


"Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene."

After running this through the BLAST tool, they find that the "noninfected" human dna/chromosomes absolutely 100 percent match the covid 19 strand.

"Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique."
They are determining based on the data before that the genetic sequences for SARs/covid 19 are not unique

"Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none."
They then attempt to show a study that shows that the PCR testing based on the data before do not show good reliability on PCR tests. This is what they are claiming supposedly
"An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection."

"RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called "junk," DNA (cDNA.)"

They are now criticizing the PCR tests and their reliability by claiming that it doesn't sequence the entire genome of the virus and that it looks for specific parts of it only.

"No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO's test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material."
Essentially their conclusion stating that these tests do not prove the existence of covid and imply that it can't test reliably due to the genome not being unique.

What do you guys think? Does this prove that PRC tests are invalid or untrustworthy? There was a lot of jargon in there I tried to take out but I did the best I could in translating to my words :)

So far here are my personal takes
-This article fails to explain why the PRC accuracy tests are so high EVEN IF what is said is true
-Their last statement seems to heavily hinge on the assumption that the virus has NEVER been isolated.
 
"The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2."
They are talking about the specific gene sequence that identifies the covid 19 virus

"However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes."
I think the key flaw is in this section. The PCR test isolates RNA, so there is no DNA in the sample. The language is dense but let's assume the first paragraph's ATGAGCTTAGTCCTGTTG forward primer sequence means that this is the sample sequence and not the actual primer sequence, which would be reversed. Now you run a BLAST search on this RNA sequence and you get DNA matches (2nd paragraph mentions chromosomes), you're comparing apples to oranges and claiming equivalence. When you run BLAST, you get all sequence matches, not just RNA matches. There's probably a way to filter the results but I've spent enough time on this today.

I tired replicating these searches with BLAST, but couldn't figure out how to search for ATGAGCTTAGTCCTGTTG while using a tablet. Here's the link to the correct and complete genome. There's a link to BLAST in the right-hand column, but that link defaulted to searching for the compete genome, not portions.

https://www.ncbi.nlm.nih.gov/nuccore/MN908947
 
"Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none."
Did I miss something? Nine percent plus eighteen percent plus seventy-three percent equals 100%. How does that leave "many" that were potentially positive for none?
 
The thing is that the development of the first published diagnostic rt-PCR test (WHO on 13 January 2020) has been well documented by the developing team at the Charité in Berlin. It is obvious that this test
a) used an established technology, laboratories already had commercially available machines that could run tests in batches of 100 and simply needed to be set up to run the new test, and
b) had been extremely well validated against false positives on real samples from real people.

The following quotes are out of order and contain unmarked elisions and emphasis by me.
Article:
Real-time RT-PCR is widely deployed in diagnostic virology. In the case of a public health emergency, proficient diagnostic laboratories can rely on this robust technology to establish new diagnostic tests within their routine services before pre-formulated assays become available.

The present report describes the establishment of a diagnostic workflow for detection of an emerging virus in the absence of physical sources of viral genomic nucleic acid. Effective assay design was enabled by the willingness of scientists from China to share genome information before formal publication, as well as the availability of broad sequence knowledge from ca 15 years of investigation of SARS-related viruses in animal reservoirs. The relative ease with which assays could be designed for this virus, in contrast to SARS-CoV in 2003, proves the huge collective value of descriptive studies of disease ecology and viral genome diversity.

Technical qualification data based on cell culture materials and synthetic constructs, as well as results from exclusivity testing on 75 clinical samples, were included in the first version of the diagnostic protocol provided to the WHO on 13 January 2020. Based on efficient collaboration in an informal network of laboratories, these data were augmented within 1 week comprise testing results based on a wide range of respiratory pathogens in clinical samples from natural infections.

Using the E and RdRp gene assays, we tested a total of 297 clinical samples from patients with respiratory disease from the biobanks of five laboratories that provide diagnostic services (one in Germany, two in the Netherlands, one in Hong Kong, one in the UK). We selected 198 samples from three university medical centres where patients from general and intensive care wards as well as mainly paediatric outpatient departments are seen (Germany, the Netherlands, Hong Kong). The remaining samples were contributed by national public health services performing surveillance studies (RIVM, PHE), with samples mainly submitted by practitioners. The samples contained the broadest range of respiratory agents possible and reflected the general spectrum of virus concentrations encountered in diagnostic laboratories in these countries (Table 2). In total, this testing yielded no false positive outcomes.

Basically, by January 20th 2020 it was known that if you ran this test on a nasal swab sample, and it was positive, that patient either had a SARS-nCoV infection, or the lab screwed up. The test would not detect any other, harmless human coronavirus (nor influenza etc.), but it would detect a large number of bat SARS mutants, which bode well for the test's ability to detect future mutations.

The test was also validated with antibody testing once the epidemic reached Germany. Drosten, one of the authors of that test, explains (my translation below):
Article:
Selbstverständlich wurden im Fall von Sars-CoV-2 in der Anfangsphase vielfach Antikörpertests zur nachträglichen Bestätigung der Infektion durchgeführt (Bsp. aus Deutschland: Wölfel at al, Nature 2020 anhand der "Webasto-Kohorte"). Die nachträgliche Bestätigung einer Infektion bei PCR-Positiven durch Antikörpertestung gelingt dabei in so großer Regelmäßigkeit, dass eine obligatorische Bestätigung aus labormedizinischer Sicht verzichtbar ist.
External Quote:
Of course, in the beginning many antibody tests were done to confirm a SARS-CoV-2 infection (published e.g. Wölfl et al, Nature 2020, based on the Webasto cohort in Germany). Using an antibody test to confirm an infection for PCR-positive patients has had such a high success rate that, from a diagnostic laboratory perspective, this confirmation was deemed unnecessary.
If the rt-PCR test regularly detected human DNA or microbes, that would have shown up in validation, both on the 297 patient samples as well as the antibody confirmation tests. The reason it doesn't is that DNA is found inside cells and thus doesn't get amplified during rt-PCR; the virus RNA is "loose" and does.
Article:
Reverse transcription polymerase chain reaction (RT-PCR) is a laboratory technique combining reverse transcription of RNA into DNA (in this context called complementary DNA or cDNA) and amplification of specific DNA targets using polymerase chain reaction (PCR).[1]​ It is primarily used to measure the amount of a specific RNA.
 
"RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called "junk," DNA (cDNA.)"
They are now criticizing the PCR tests and their reliability by claiming that it doesn't sequence the entire genome of the virus and that it looks for specific parts of it only.
The claim [that "RT-PCR tests do not sequence the entire genome"] is true; it is the reason PCR tests exist.Gene sequencing is a comparatively complex process, and it can't be done in big batches like PCR tests can. By only looking for key parts of the virus, a PCR test is simpler and faster, but still very reliable.

But PCR-positive samples get sequenced all the time; by tracking SARS-CoV-2 mutations via phylogenetic trees, researchers gain insights on how the virus spread across the planet, and detect emerging new strains.

Article:

Global Collaborations to Collect and Analyze SARS-CoV-2 Sequence Data

After the first SARS-CoV-2 genome was published, scientists all over the world soon realized the immediate necessity to obtain as much genetic information from as many SARS-CoV-2 strains as possible. [..] In an effort to standardize sequencing procedures, an international workgroup called Advancing Real-Time Infection Control Network (ARTIC), consisting of scientists from the U.K., Belgium and the U.S., devised a method of SARS-CoV-2 whole genome sequencing (WGS) on the Oxford Nanopore Technologies sequencing platforms. The protocol has since been adapted for other sequencing platforms, allowing more laboratories to study the genome of the virus.

One of the largest curated international repositories of SARS-CoV-2 sequence data is hosted by
GISAID (Global Initiative on Sharing All Influenza Data). As of September 2020, almost 100,000 full SARS-CoV-2 genomic sequences, along with key contextual information (metadata) associated with each sequence, have been uploaded and shared on the GSAID SARS-CoV-2 Genomic Epidemiology (EpiCov) platform.
NextStrain-SARS-CoV-2-TransmissionByClade-874x592.png

If PCR tests routinely matched SARS-unrelated genetic material, this would be obvious by now through this huge ongoing worldwide sequencing effort.
 
Last edited:
The claim is true; it is the reason PCR tests exist.Gene sequencing is a comparatively complex process, and it can't be done in big batches like PCR tests can. By only looking for key parts of the virus, a PCR test is simpler and faster, but still very reliable.

But PCR-positive samples get sequenced all the time; by tracking SARS-CoV-2 mutations via phylogenetic trees, researchers gain insights on how the virus spread across the planet, and detect emerging new strains.

Article:

Global Collaborations to Collect and Analyze SARS-CoV-2 Sequence Data

After the first SARS-CoV-2 genome was published, scientists all over the world soon realized the immediate necessity to obtain as much genetic information from as many SARS-CoV-2 strains as possible. [..] In an effort to standardize sequencing procedures, an international workgroup called Advancing Real-Time Infection Control Network (ARTIC), consisting of scientists from the U.K., Belgium and the U.S., devised a method of SARS-CoV-2 whole genome sequencing (WGS) on the Oxford Nanopore Technologies sequencing platforms. The protocol has since been adapted for other sequencing platforms, allowing more laboratories to study the genome of the virus.

One of the largest curated international repositories of SARS-CoV-2 sequence data is hosted by
GISAID (Global Initiative on Sharing All Influenza Data). As of September 2020, almost 100,000 full SARS-CoV-2 genomic sequences, along with key contextual information (metadata) associated with each sequence, have been uploaded and shared on the GSAID SARS-CoV-2 Genomic Epidemiology (EpiCov) platform.
View attachment 47238

If PCR tests routinely matched SARS-unrelated genetic material, this would be obvious by now through this huge ongoing worldwide sequencing effort.
So what they are saying is based on some truth but it doesn't actually disprove the accuracy of PCR tests?
 
Their last statement seems to heavily hinge on the assumption that the virus has NEVER been isolated.
There's a great article debunking that, which is worth reading in full. Here's an excerpt:
Article:
Associate Professor Siouxsie Wiles is a microbiologist from the Department of Molecular Medicine and Pathology in the Faculty of Medical and Health Sciences' School of Medical Sciences [of the University of Auckland, New Zealand].

The worst thing about Koch's postulates is that they were formulated before viruses were known to exist. Viruses aren't like the bacteria that Koch was busy discovering. Viruses need to take over a host cell to replicate. In other words, they turn cells into virus-producing factories. And depending on what proteins a virus has on its surface, it may only be able to infect very specific cells from certain host species, or a wide range of cells from lots of different species.

That's why when virologists want to isolate a virus from a sample they'll take the sample or some part of it and add it to some cells – usually ones that are relatively easy to grow in the lab – and then look to see if the cells die and/or if there are any virus particles released into the liquid nutrient bath the cells are growing in.


In other words, viruses can't be grown in pure culture as described by Koch's postulates because they need a cell to grow in. Does that mean viruses don't cause disease? No.

[Prof. Wiles then talks about the Covid-deniers alleged "proof" that the virus hasn't been "isolated":]


The copies of the [FOIA] requests I've been sent also go on to state:


"Please note that I am using "isolation" in the every-day sense of the word: the act of separating a thing(s) from everything else. I am not requesting records were "isolation of SARS-COV-2" refers instead to: the culturing of something, or the performance of an amplification test (ie a PCR test), or the sequencing of something."​
​
In other words, the people asking for evidence of the existence of the SARS-CoV-2 virus responsible for Covid-19 are specifically wording their request to rule out obtaining any evidence that the virus exists. As I've pointed out, viruses need a host cell to replicate in which is why samples are combined with another "source of genetic material". This is just biology.

And as for using isolation in the every-day sense of the word, rather than the definition that is relevant to the question being asked? Well, that's just bloody ridiculous and a clear sign these requests for evidence are not being made in good faith.


Compare Prof. Wiles's description with "Isolation and characterization of SARS-CoV-2 from the first US COVID-19 patient" (emphasis mine):
Article:
A patient was identified with confirmed COVID-19 in Washington State on January 22, 2020 with cycle threshold (Cts) of 18–20 (nasopharyngeal(NP)) and 21–22 (oropharyngeal (OP)) (1). The positive clinical specimens were aliquoted and refrozen inoculation into cell culture on January 22, 2020. We first observed cytopathic effect (CPE) 2 days post inoculation and harvested viral lysate on day 3 post inoculation (Figure 1B and and1C).1C). Fifty μl of P1 viral lysates were used for nucleic acid extraction to confirm the presence of SARS-CoV-2 using the CDC molecular diagnostic assay (1). The Cts of three different nucleic acid extractions ranged from 16.0–17.1 for N1, 15.9–17.1 for N2 and 16.2–17.3 for N3, confirming isolation of SARS-CoV-2. A Ct of less than 40 is considered positive. The extracts were also tested for the presence of 33 additional different respiratory pathogens with the fast track 33 assay. No other pathogens were detected. Identity was additionally supported by thin section electron microscopy (Figure 1D). We observed a morphology and morphogenesis characteristic of coronaviruses.

They took a sample from a sick patient, grew it in a cell culture, and found that the cells got sick and produced lots more coronavirus (SARS-CoV-2), but nothing else that could cause pneumonia. The virus produced did looked like a coronavirus under the electron microscope.

Personally, I find that pretty convincing proof that the virus exists.
 
Last edited:
So what they are saying is based on some truth but it doesn't actually disprove the accuracy of PCR tests?
Yes.

Specifically, the claim "RT-PCR tests do not sequence the entire genome" is true, but the part about "junk DNA" is false or misleading. rt-PCR-positive samples get sequenced all the time, and these full gene sequences are closely related.
 
Back
Top